Sentromer DNA Teknolojileri ürün ve hizmetleri ile yapılan çalışmalara ait başlıca yayınlar
Endoplasmic reticulum stress triggers ROS signalling, changes the redox state, and regulates the antioxidant defence of Arabidopsis thaliana R Ozgur, I Turkan, B Uzilday… - Journal of experimental …, 2014 - Soc Experiment Biol ... The primers for Actin8, bZIP17, bZIP28, bZIP60, BiP1, BiP3, TIN1, ERO1, RBOHD, and RBOHF are given in Supplementary Table S1 (available at JXB online). The primers were synthesized by Sentromer DNA Technologies (Istanbul, Turkey). Enzyme extraction and assays. ...
Genotyping of Acanthamoeba T15: the environmental strain in Turkey G Evyapan, IS Koltas, F Eroglu - Transactions of The …, 2014 - trstmh.oxfordjournals.org ... All PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA, Istanbul, Turkey), and were sequenced using the DNA sequencing kit Big Dye Terminator (Applied Biosystems, San Fransisco, CA, USA) according to the manufacturer's instructions. ...
Food Handlers: a bridge in the journey of enterotoxigenic MRSA in Food Ç Sezer, Ç Özgür, A Aksem, V Leyla - Journal für Verbraucherschutz und …, 2015 - Springer ... The reaction mixture also contained 1× Taq buffer (Vivantis, S buffer with MgCI 2 17.5 mM), 1 U taq DNA polymerase (Vivantis, PL1202 5U/µl), 0.2 mM of dNTP mix (Vivantis, NP2406), 0.6 mM of forward and reverse primers (Sentromer DNA Technologies, Istanbul, Turkey) and ...
The prevalence of three viruses infecting fig in southern Turkey BK Caglar, H Fidan, ME Guldur… - Journal of …, 2011 - Wiley Online Library ... Escherichia coli SoloPACK cells. All plasmids containing DNA fragments were subjected to automated sequencing (ABI3730; Applied Bio., Sentromer DNA Teknolojileri Ltd. Co., Adana, Turkey). Nucleotide sequence analysis ...
Development of an optical biosensor based on surface-enhanced Raman scattering for DNA analysis T Yigit, E Akdogan, ID Karagoz… - SPIE …, 2016 - proceedings.spiedigitallibrary.org ... 2. EXPERIMENTAL SECTION 2.1 Materials Oligonucleotides were purchased from Sentromer DNA Technology (Turkey), gold(III) chloride trihydrate, trisodium citrate dihydrate, and 4-Aminothiophenol (4-ATP) were purchased from Sigma-Aldrich (USA). ...
Electrochemical impedance spectroscopic study of single-stranded DNA-immobilized electroactive polypyrrole-coated electrospun poly (ε-caprolactone) nanofibers Z Guler, P Erkoc, AS Sarac - Materials Express, 2015 - ingentaconnect.com Page 1. Delivered by Publishing Technology to: ? IP: 93.91.26.12 On: Sun, 17 Apr 2016 16:54:31 Copyright: American Scientific Publishers Materials Express Article Copyright © 2015 by American Scientific Publishers All rights reserved. Printed in the United States of America ...
Molecular phylogeny of Anatolian and Cypriot donkey populations based on mitochondrial DNA and Y-chromosomal STRs. BC KUL, N Bilgen, B Akyuz… - Ankara Üniversitesi …, 2016 - dergiler.ankara.edu.tr ... A total of 30 male donkey samples were also amplified by PCR for three equine Y chromosomal STR loci, namely Eca.YM2, Eca.YP9 and Eca.YE1. Forward primers were synthesized by 5' end labeling with fluorescent dyes (Sentromer DNA Ltd, Istanbul, Turkey). ...
Butyrylcholinesterase expression is regulated by fatty acids in HepG2 cells M Gok, ND Zeybek, E Bodur - Chemico-biological interactions, 2016 - Elsevier ... forward GAATGCCACAAAATATGCAAATTCTTGCTGTCAG, reverse GCTCTGGTGAACAAT GAATGGCTTCCAGGAGAAAG; beta-actin: forward AGAAAATCTGGCACCACACC, reverse GGGGTGTTGAAGGTCTCAAA and synthesized by Sentromer DNA Teknolojileri, Turkey. ...
Akut Gastroenteritli Hastalarda Campylobacter jejuni Alt Tipleri ile Koenfeksiyonu AT ile Koenfeksiyon - tmc.dergisi.org Tuba KAYMAN*, Fuat AYDIN**, Seçil ABAY**, Kadir Serdar DİKER** ... 5 μl 10xPCR buffer A (Fermentas, Litvanya), 4 mM MgCl2 (Fermentas, Litvanya), 5 U Taq DNA polymerase (Fermentas, Litvanya), final konsantrasyonu 0.2 mM olacak şekilde dNTP (Fermentas, Litvanya) karışımı, 25 pmol primerler (Sentromer DNA Teknolojileri, İstanbul, Türkiye ...
Screening of Hallucinogenic Compounds and Genomic Characterisation of 40 Anatolian Salvia Species SD Hatipoglu, B Yalcinkaya, M Akgoz… - Phytochemical …, 2017 - Wiley Online Library ... I Master Mix, 10 ng of each DNA extract and 20 pmol of forward (F:5′-GTGCTTGGGCGAGA GTAGTA-3′) and 20 pmol of reverse (R:5′-TTAGTGCTGGTATGATCGCA-3′) primers (Bertea et al., 2006) which were synthesised and purified by HPLC (Sentromer, Istanbul, Turkey ...
The effects of induced production of reactive oxygen species in organelles on endoplasmic reticulum stress and on the unfolded protein response in … R Ozgur, B Uzilday, AH Sekmen, I Turkan - Annals of botany, 2015 - Annals Botany Co ... CNX (AT5G61790), ERO1 (AT1G72280), HRD1 (AT1G65040), SEL1 (AT1G18260), DER1 (AT4G29330) and UBC32 (AT3G17000) were identified by qRT-PCR. The primers were synthesized by Sentromer DNA Technologies.
The Effects of Melatonin on Transcriptional Profile of Unfolded Protein Response Genes Under Endoplasmic Reticulum Stress in Arabidopsis thaliana R Ozgur, B Uzilday, I Turkan, AH Sekmen - - Plant Molecular Biology …, 2017 - Springer ... identified by qRT-PCR. Accession numbers of the genes and the primers used in this study can be found in Table 1, which were synthesized by Sentromer DNA Technologies (Istanbul, Turkey).
Self-assembly of DNA wrapped carbon nanotubes and asymmetrical cyanine dyes into fluorescent nanohybrids O Cavuslar, H Unal - RSC Advances, 2015 - pubs.rsc.org ... ssDNA composed of 20 Guanines (Poly(G) 20 ) was synthesized by Sentromer DNA Technologies, Istanbul, Turkey. Centrifugal filter devices with a 30 kDa cut-off membrane (Microcon-30 kDa) were purchased from Millipore. ...
Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under … B Uzilday, R Ozgur, AH Sekmen, E Yildiztugay… - Annals of …, 2015 - Annals Botany Co ... Primers and accessions for arabidopsis and Eutrema homologues of the genes can be found in Supplementary Data Table S1. The primers were synthesized by Sentromer DNA Technologies (Istanbul, Turkey). Statistical analysis. ...
Production of antimicrobial metabolite from a local Penicillium sp. novel strain MF Al-Jawad, MJ Al-Jassani… - Current Research in …, 2015 - researchgate.net ... ITS rRNA genes were amplified using primers ITS1 and ITS4 (Sentromer DNA Technologies LTD., Istanbul, Turkey) (Table 2), as described previously by [15]. An optimized recipe was used in the PCR reaction (Table 3). About 500-800 bp of the internal transcribed spacer ...
The role of domestic tap water on Acanthamoeba keratitis in non-contact lens wearers and validation of laboratory methods IS Koltas, F Eroglu, E Erdem, M Yagmur, F Tanır - Parasitology research, 2015 - Springer ... PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA Technologies, Istanbul, Turkey) and sequenced using the BigDye Terminator V 3.1 cycle sequencing kit (Applied Biosystems, California, USA) as per the manufacturer's protocol on the ABI ...
Corrosive Lesions at Concrete Infrastructures as Promising Source for Isolating Bioactive Actinobacteria R Omran - American Journal of Life Sciences, 2015 - Citeseer ... 5`AGAGTTTGATCCTGGCTCAG 3` and Ab939R: 5` CTTGTGCGGGCCCCCGT CAATTC 3`. The oligonucleotide primers were synthesized by Sentromer DNA Technologies LTD., Istanbul, Turkey. The PCR program used was ...
Investigation of mutations in adeR and adeS gene regions in gentamicine resistant Acinetobacter baumannii isolates AR Atasoy, IH Ciftci, M Petek… - Biotechnology & …, 2016 - Taylor & Francis ... suitability. The primers used in this study (Table 2) were supplied by Sentromer DNA Technologies (Turkey). Investigation of mutations in adeR and adeS gene regions in gentamicine resistant Acinetobacter baumannii isolates. ...
Cucurbit yellow stunting disorders (CYSDV) and Cucumber vein yellowing virus (CVYV) diseases on melon and cucumber in Turkey H Fidan, M Unlu, A Unlu, MA YILMAZ - … International Meeting on …, 2012 - researchgate.net ... 3European University of Lefke, Faculty of Agricultural Sciences and Technologies, Northern Cyprus ... were performed using Taq Polymerase (Fermantas DreamTaq™ Green DNA Polymerase), according ... The amplicons were then directed sequenced by SENTROMER Company. ...
Comparison of clinical samples and methods in chronic cutaneous leishmaniasis F Eroglu, S Uzun, IS Koltas - The American journal of tropical medicine and …, 2014 - ASTMH ... PCR products were purified using a SentroPure DNA Purification Kit (Sentromer DNA, Istanbul, Turkey), and they were sequenced with the same combination of primers using the BigDye Terminator V 3.1 Cycle Sequencing Kit (Applied Biosystems) according to the protocol of ...
Subtype analysis of Blastocystis isolates using SSU rRNA-DNA sequencing in rural and urban population in southern Turkey IS Koltas, F Eroglu - Experimental Parasitology, 2016 - Elsevier ... electrophoresis buffer. 2.3. DNA sequencing and phylogenetic analyses. The PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA, Istanbul, Turkey)
The emergence of Leishmania major and Leishmania donovani in southern Turkey IS Koltas, F Eroglu, D Alabaz… - Transactions of The …, 2014 - trstmh.oxfordjournals.org ... The results of real-time PCR were confirmed by the Leishmania ITS1 DNA sequencing method. The PCR was carried out using the LITSR-L5.8S primers. 14 PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA, Istanbul, Turkey). ...
A comparative analysis of different molecular targets using PCR for diagnosis of old world leishmaniasis IS Koltas, F Eroglu, S Uzun, D Alabaz - Experimental parasitology, 2016 - Elsevier ... The PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA, Istanbul, Turkey) and they were sequenced with the BigDye Terminator V 3.1 cycle sequencing kit (Applied Biosystems, California, USA) according to manufacturers' protocol on the 3730 ...
Y‐chromosomal variation of local goat breeds of Turkey close to the domestication centre B Cinar Kul, N Bilgen, JA Lenstra… - Journal of Animal …, 2015 - Wiley Online Library ... Polymerase chain reactions. The amplicon sizes, annealing temperatures and primer pairs (Sentromer DNA ltd, Istanbul, Turkey) for amplifying the AMELY, ZFY, SRY 3′ untranslated region (UTR) and SRY promoter (SRY-ORF) are listed in the Table S1. ...
Clinical manifestations and genetic variation of Leishmania infantum and Leishmania tropica in Southern Turkey F Eroglu, IS Koltas, D Alabaz, S Uzun… - Experimental …, 2015 - Elsevier ... The ITS1 PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA, Istanbul, Turkey), and they were sequenced using the sense primer and the DNA sequencing kit Big Dye Terminator TM (Applied Biosystems, California, USA) according to the ...
İnsan Serum Bütirilkolinesterazının Karaciğer Hepg2 Hücrelerinde Lipid Metabolizması ile Etkileşiminin İncelenmesi. M Gök - 2015 - openaccess.hacettepe.edu.tr Page 1. TC HACETTEPE ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ İNSAN SERUM BÜTİRİLKOLİNESTERAZININ KARACİĞER HEPG2 HÜCRELERİNDE LİPİT METABOLİZMASI İLE ETKİLEŞİMİNİN İNCELENMESİ Müslüm GÖK Biyokimya Programı ... ( TEZ PROJESİ )
Comparison of DNA extraction methods for meat analysis B Yalçınkaya, E Yumbul, E Mozioğlu, M Akgoz - Food Chemistry, 2017 - Elsevier ... DNA sample was used as DNA template and 3 replicates were run. Forward and reverse primers were synthesized and purified by HPLC (F:5′-GAA CTA CGG CTG AAT CAT CCG A-3′; R:5′-GGT AGG ACG TAT CCT ATA AAT GCT GTG-3′; Sentromer, Türkiye) (Yalçınkaya ...
Halal authenticity of sausage samples by qPCR analysis B Yalçinkaya, M Akgöz - Journal of Chemical Metrology, 2015 - search.proquest.com ... Master Mix. The PCR was performed in a total volume of 20 l with 10 ng of each DNA sample and corresponding primers (Table 1, [5]). DNA primers were synthesized and purified by HPLC (Sentromer, Turkey). After an initial ...
Carriage rate and methicillin resistance of Staphylococcus aureus in food handlers in Kars City, Turkey L Vatansever, Ç Sezer, N Bilge - SpringerPlus, 2016 - springerplus.springeropen.com ... The each PCR mixture contained 100 ng genomic DNA, 1× taq buffer (Vivantis, S buffer with MgCl 2 17.5 mM), 1 U taq DNA polymerase (Vivantis, PL 1202-5/µl), 0.2 mM of dNTP mix (Vivantis, NP2406), 0.6 mM of forward and reverse primers (Sentromer/Turkey) and sterile ...
Halal food and Metrology AC GÖREN, H Yılmaz, S Gündüz… - 2 nd. International …, 2013 - helalvesaglikli.org ... and purified by HPLC (Sentromer, Türkiye). After an initial denaturation at 95 °C for 5 min., 35 cycles were performed by denaturing at 95 °C for 15 s, annealing at 58 °C for 15 s, and extending at 72 °C for 30 s. For each amplification mixture, 5 µl of each DNA sample was used ...
Investigation of enteropathogenic Escherichia coli and Shiga toxin-producing Escherichia coli associated with hemolytic uremic syndrome in İzmir Province, Turkey E Bozcal, G YİĞİTTÜRK, A Uzel… - Turkish journal of …, 2016 - journals.tubitak.gov.tr ... as follows: the multiplex PCR was performed in a 25-µL reaction mixture consisting of 1.25 U of Taq DNA polymerase (Fermentas, Germany), 1X Taq polymerase buffer (Fermentas), 0.3 mM concentration of each dNTP (Fermentas), and 0.4 mM of each primer (Sentromer, Turkey ...
Occurrence and antimicrobial resistance of Salmonella enterica subsp. enterica serovars Typhimurium, Enteritidis, and Typhi isolated from chicken eggs and poultry … S AL, H HIZLISOY, NE ONMAZ… - Turkish Journal of …, 2016 - journals.tubitak.gov.tr ... in Table 1. PCR was performed in a reaction mixture with final volume of 50 µL containing 5 µL of template DNA, 5 µL of 10X PCR buffer (Vivantis), 1.5 U of Taq polymerase (Vivantis), 500 µM dNTP mix (Vivantis), 3 mM MgCl2 (Vivantis), and 25 pmol of each primer (Sentromer). ...
Erciyes Üniversitesi Veteriner Fakültesi Dergisi TGAKD Durumu - dergipark.gov.tr Journal of Faculty of Veterinary Medicine, Erciyes University Araştırma Makalesi / Research Article 12(2), 81-92, 2015 (Alttaki ile aynı yayın)
Broiler Karkaslarından İzole Edilen Campylobacter jejuni İzolatlarının Makrolid, Kinolon ve Tetrasiklin Grubu Antibiyotiklere Karşı Direnç Durumu. H HIZLISOY, H KILIÇ - Journal of Faculty of Veterinary …, 2015 - search.ebscohost.com ... sa- dece dört çift primer kullanıldı (Tablo 1). Çalışmada C. jejuni identifikasyonu ve izolatlarının antibiyotik dirençlerinin moleküler yöntemle araştırılmasında kullanılan primerler (Sentromer, İstanbul), Tablo 1'de verildi. Çalışmada kullanılan plazmid ve kro- mozomal DNA'lar ise ...
Occurrence of Alfalfa Mosaic Virus (AMV) Diseases on Potato Crops in Northern Cyprus H Fidan, NA Adak, A Konuksal, E Akerzurumlu… - V Balkan Symposium …, 2011 - actahort.org ... PCRs were performed using Taq Polymerase (Fermantas DreamTaq™ Green DNA Polymerase), according to manufacturer's recommendations and 0.2 µM of each AMV-F and AMV-R ... 1). Direct sequence analysis of the RT- PCR products were made by SENTROMER Inc. ...
Molecular Identification and DNA Sequencing of Trichomonas vaginalis Strains from Agean region of Turkey Koltas, I.S., Inceboz, T., Inceboz, U., Evyapan, G.and Derici, Y. Tropical Biomedicine  34(1): 66–71 (2017) All of the PCR products were purified using a Sentro Pure DNA purification kit (Sentromer DNA, Istanbul, Turkey), and they were sequenced with DNA sequencing kit Big Dye Terminator TM (Applied Biosystems, California, USA) according to the manu- facturer’s instructions. 18S rRNA-DNA gene sequencing of  Trichomonas vaginalis was performed by ABI Prism 310TM Genetic Analyser (Applied Biosystems, California, USA).
Impedimetric DNA biosensor based on polyurethane/poly(m-anthranilic acid) nanofibers ZelihaGuler Gokce, PınarAkalın, Fatma Neşe Kok, A.Sezai Sarac Sensors and Actuators B: Chemical Volume 254, January 2018, Pages 719-726 The probe DNA fragments were amino modified at their 5′-end and HPLC purified. The modified and standard oligonucleotides were synthesized by Sentromer DNA Technologies LLC, Istanbul, Turkey.
Are soil and waterborne parasitic infections health risk for worker populations in southeast Turkey? S Ak, F Eroğlu, Aİ Nergiz, F Hıyamlı - 2017 - dergipark.gov.tr ... DNA sequencing All of Acanthamoeba PCR products were purified using a SentroPure DNA purification kit (Sentromer DNA, Istanbul, Turkey) and they were sequenced with DNA sequencing kit Big Dye TerminatorTM (Applied Biosystems, California, USA) according to the ...
Genotyping of single nucleotide polymorphism by probe-gated silica nanoparticles M Ercan, VC Ozalp, BG Tuna - Analytical biochemistry, 2017 - Elsevier ... Genomic DNA was isolated from about 200 μl of blood samples by GenElute miniprep kit (Sigma-Aldrich). ... annealing at 58 °C, and 45 s of elongation at 68 °C. The final product OF 421 bp was directly sequenced with SF primer with Sanger method by Sentromer (Istanbul, Turkey ...
DNA Directed Self-Assembly of Single Walled Carbon Nanotubes into Three-Way Junction Nanostructures Betul Oruc, Suleyman Celik, Serap Hayat Soytas, Hayriye Unal - ACS Omega 2018, 3, 4157−4162... ssDNA strands to prepare DNA-3WJ nanostructures were synthesized by Sentromer DNA Technologies, Istanbul, Turkey.
Exploring the genetic variations and population structure of Turkish pepper (Capsicum annuum L.) genotypes based on peroxidase gene markers Rıfat Akyavuz, Bilgin Taskin, Metin Koçak, Mehtap Yildiz - 3 Biotech (2018) 8:355... Oligonucleotides were synthesized by Sentromer DNA Technologies, Istinye, Istanbul.
Niğde ve Kayseri’de Satışa Sunulan Köy ve Market Yumurtalarının Mikrobiyolojik Kalitesi Fulden KARADAL ,Nurhan ERTAS ONMAZ , Harun HIZLISOY , Yeliz YILDIRIM , Serhat AL , Zafer GONULALAN , İsmail ÜLGER- Erciyes Üniversitesi Veteriner Fakültesi Dergisi 15(1), 51-57, 2018... ve her primerden 25 pmol (Sentromer DNA Teknolojileri, Türkiye) içeren 50 μL hacimde reaksiyon karışımı hazırlandı.